Table 10
Set XI (diversity) Fluorescent Primer Information
(Made in October 2001)

Symbol Chromosome Fluorescent Dye Type Forward Primer Length Reverse Primer Length
CGA 1 HEX GENE ATAGACATTATGTAAGTTGCTGAT 24 GAACTTTCACATCCCTAAGGTCGT 24
S0155 1 FAM DNA TGTTCTCTGTTTCTCCTCTGTTTG 24 AAAGTGGAAAGAGTCAATGGCTAT 24
SW1828 1 TET DNA AATGCATTGTCTTCATTCAACC 22 TTAACCGGGGCACTTGTG 18
S0226 2 FAM DNA GGTTAAACTTTTNCCCCAATACA 23 GCACTTTTAACTTTCATGATGCTCC 25
SW240 2 TET DNA AGAAATTAGTGCCTCAAATTGG 22 AAACCATTAAGTCCCTAGCAAA 22
S0002 3 HEX DNA GAAGCCAAAGAGACAACTGC 20 GTTCTTTACCCACTGAGCCA 20
SW72 3 FAM DNA ATCAGAACAGTGCGCCGT 18 TTTGAAAATGGGGTGTTTCC 20
SW902 3 FAM DNA ATCAGTTGGAAATGATGGCC 20 CTTGCCTCAAAGAGTTGTAAGG 22
S0097 4 TET DNA GACCTATCTAATGTCATTATAGT 23 TTCCTCCTAGAGTTGACAAACTT 23
S0217 4 TET DNA TGTGATGCAGGCTGGCAG 18 GCCTCCTCATCTGGGGTC 18
S0227 4 HEX DNA GATCCATTTATAATTTTAGCACAAAGT 27 GCATGGTGTGATGCTATGTCAAGC 24
S0301 4 FAM DNA CCGTCTTACTTAGGATGTTT 20 TGATGTGTTTATGTGTTTGA 20
IGF1 5 FAM GENE ACCCTTGAGAGGGTATTGCTAGGC 24 GGGCAAAGATTCTGCTGAGCTG 22
S0005 5 TET DNA TCTTCCCTCCTGGTAACTA 20 GCACTTCCTGATTCTGGGTA 20
S0228 6 TET DNA GGCATAGGCTGGCAGCAACA 20 AGCCCACCTCATCTTATCTACACT 24
SW1067 6 HEX DNA TGCTGGCCAGTGACTCTG 18 CCGGGGGATTAAACAAAAAG 20
SW122 6 FAM DNA TTGTCTTTTTATTTTGCTTTTGG 23 CAAAAAAGGCAAAAGATTGACA 22
SW2406 6 TET DNA AATGTCACCTTTAAGACGTGGG 22 AATGCGAAACTCCTGAATTAGC 22
S0025 7 FAM DNA TCTCCCTTCCCTCCATCTCT 20 CTCCATCAGCCAAAAACATT 20
S0101 7 HEX DNA GAATGCAAAGAGTTCAGTGTAGG 23 GTCTCCCTCACACTTACCGCAG 22
SW632 7 TET DNA TGGGTTGAAAGATTTCCCAA 20 GGAGTCAGTACTTTGGCTTGA 21
S0178 8 TET DNA TAGCCTGGGAACCTCCACACGCTG 24 GGCACCAGGAATCTGCAATCCAGT 24
S0225 8 HEX DNA GCTAATGCCAGAGAAATGCAGA 22 CAGGTGGAAAGAATGGAATGAA 22
SW2410 8 HEX DNA ATTTGCCCCCAAGGTATTTC 20 CAGGGTGTGGAGGGTAGAAG 20
SW174 9 TET DNA GCCAAAATAGCTATTGGACAGC 22 TCATGCTATTTTGTTCCAGATG 22
SW911 9 FAM DNA CTCAGTTCTTTGGGACTGAACC 22 CATCTGTGGAAAAAAAAAGCC 21
S0070 10 HEX DNA GGCGAGCATTTCATTCACAG 20 GAGCAAACAGCATCGTGAGC 20
SW830 10 FAM DNA AAGTACCATGGAGAGGGAAATG 22 ACATGGTTCCAAAGACCTGTG 21
SW951 10 HEX DNA TTTCACAACTCTGGCACCAG 20 GATCGTGCCCAAATGGAC 18
S0386 11 TET DNA TCCTGGGTCTTATTTTCTA 19 TTTTTATCTCCAACAGTAT 19
SW2008 11 HEX DNA CAGGCCAGAGTAGCGTGC 18 CAGTCCTCCCAAAAATAACATG 22
S0090 12 FAM DNA CCAAGACTGCCTTGTAGGTGAATA 24 GCTATCAAGTATTGTACCATTAGG 24
S0143 12 TET DNA ACTCACAGCTTGTCCTGGGTGT 22 CAGTCAGCAGGCTGACAAAAAC 22
S0068 13 TET DNA AGTGGTCTCTCTCCCTCTTGCT 22 CCTTCAACCTTTGAGCAAGAAC 22
S0215 13 HEX DNA TAGGCTCAGACCCTGCTGCAT 21 TGGGAGGCTGAAGGATTGGGT 21
SW769 13 FAM DNA GGTATGACCAAAAGTCCTGGG 21 TCTGCTATGTGGGAAGAATGC 21
SWR1941 13 TET DNA AGAAAGCAATTTGATTTGCATAATC 25 ACAAGGACCTACTGTATAGCACAGG 25
SW295 14 TET DNA ACCTGCCAGAGTTGTGGC 18 AAGAGTTTCATTTCTCCCATCC 22
SW857 14 HEX DNA TGAGAGGTCAGTTACAGAAGACC 23 GATCCTCCTCCAAATCCCAT 20
S0355 15 FAM DNA TCTGGCTCCTACACTCCTTCTTGATG 26 TTGGGTGGGTGCTGAAAAATAGGA 24
SW1111 15 TET DNA AGGTCCTACTGTCCATCACAGG 22 GAAGCAGAGTTGGCTTACAGTG 22
SW936 15 FAM DNA TCTGGAGCTAGCATAAGTGCC 21 GTGCAAGTACACATGCAGGG 20
S0026 16 HEX DNA AACCTTCCCTTCCCAATCAC 20 CACAGACTGCTTTTTACTCC 20
SW742 16 HEX DNA AATTCTACTTCTGGGGAGAGGG 22 CTTTTGGGAACATTTCTGCC 20
SW24 17 TET DNA CTTTGGGTGGAGTGTGTGC 19 ATCCAAATGCTGCAAGCG 18
SWR1004 17 FAM DNA TGGGAACACCTGCTTCATTC 20 TCCATATGCCCCAAGTGTG 19
SW1023 18 FAM DNA AACCTGCTGAGCCACAGTG 19 GCAAGTACCCAATCTTTTTTCC 22
SW787 18 FAM DNA CTGGAGCAGGAGAAAGTAAGTTC 23 GGACAGTTACAGACAGAAGAAGG 23
S0218 X TET DNA GTGTAGGCTGGCGGTTGT 18 CCCTGAAACCTAAAGCAAAG 20
SW2476 X HEX DNA GAGAGGGACAGAGCTGAGAGC 21 CTTGAGGTTTGATGGCACG 19

The availability of older sets is limited. To request fluorescent primers, please either:

  1. Use the online form to fill out your request (recommend),

    or

  2. Contact the U.S. Pig Genome Coordinator Max Rothschild at the address given below, and be sure to provide the following: (1) which primer set you request; (2) your complete postal address (NOT a P.O.Box); (3) your day-time phone number and (4) a signed copy of the Disclaimer and Terms of Use of Primers.
                Max F. Rothschild
                2255 Kildee Hall
                Department of Animal Science
                Iowa State University
                Ames, Iowa 50011
                Phone: 515-294-6202
                Fax:   515-294-2401
                Email: mfrothsc@iastate.edu
    

Web Access Statistics © 1998-2019 NAGRP - U. S. Pig Genome Research Coordination Program.
Contact: The NAGRP Bioinformatics Project Team
Helpdesk